Review




Structured Review

Addgene inc yue xiong
Yue Xiong, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pm41667829-249-17-19
Average 93 stars, based on 60 article reviews
yue xiong - by Bioz Stars, 2026-09
93/100 stars

Images

Related Articles

Stable Transfection:

Article Title: Substoichiometric Hydroxynonenylation of a Single Protein Recapitulates Whole-Cell-Stimulated Antioxidant Response
Article Snippet: .. HEK cells stably expressing Halo-Keap1 were transfected with pcDNA3-myc3-Nrf2 plasmid (Addgene 21555). .. At 30–36 h post transfection, the cells were treated with 20 nM Bortezomib (LC laboratories).

Expressing:

Article Title: Substoichiometric Hydroxynonenylation of a Single Protein Recapitulates Whole-Cell-Stimulated Antioxidant Response
Article Snippet: .. HEK cells stably expressing Halo-Keap1 were transfected with pcDNA3-myc3-Nrf2 plasmid (Addgene 21555). .. At 30–36 h post transfection, the cells were treated with 20 nM Bortezomib (LC laboratories).

Transfection:

Article Title: Substoichiometric Hydroxynonenylation of a Single Protein Recapitulates Whole-Cell-Stimulated Antioxidant Response
Article Snippet: .. HEK cells stably expressing Halo-Keap1 were transfected with pcDNA3-myc3-Nrf2 plasmid (Addgene 21555). .. At 30–36 h post transfection, the cells were treated with 20 nM Bortezomib (LC laboratories).

Article Title: Proteasome activation by insulin-like growth factor-1/nuclear factor erythroid 2-related factor 2 signaling promotes exercise-induced neurogenesis.
Article Snippet: Department of Anatomy, Shanxi Medical University, Taiyuan, People's Republic of China Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Joint International Research Laboratory of CNS Regeneration Ministry of Education, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Jinan University, Guangzhou, People's Republic of China Department of Cell Biology, Neurobiology & Anatomy, Medical College of Wisconsin, Milwaukee, Wisconsin, USA Anhui Province Key Laboratory of Medical Physics and Technology, Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China Cancer Hospital, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China

Plasmid Preparation:

Article Title: Substoichiometric Hydroxynonenylation of a Single Protein Recapitulates Whole-Cell-Stimulated Antioxidant Response
Article Snippet: .. HEK cells stably expressing Halo-Keap1 were transfected with pcDNA3-myc3-Nrf2 plasmid (Addgene 21555). .. At 30–36 h post transfection, the cells were treated with 20 nM Bortezomib (LC laboratories).

Article Title: Live-cell imaging Unveils stimulus-specific dynamics of Nrf2 activation in UV-exposed melanoma cells: Implications for antioxidant compound screening.
Article Snippet: .. For the plasmid construction, we utilized the pCDNA3-Myc3-Nrf2 plasmid, generously provided by Yue (Addgene plasmid #21555), as the PCR template. ..

Article Title: Proteasome activation by insulin-like growth factor-1/nuclear factor erythroid 2-related factor 2 signaling promotes exercise-induced neurogenesis.
Article Snippet: Department of Anatomy, Shanxi Medical University, Taiyuan, People's Republic of China Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Joint International Research Laboratory of CNS Regeneration Ministry of Education, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Jinan University, Guangzhou, People's Republic of China Department of Cell Biology, Neurobiology & Anatomy, Medical College of Wisconsin, Milwaukee, Wisconsin, USA Anhui Province Key Laboratory of Medical Physics and Technology, Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China Cancer Hospital, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China

Article Title: Nrf2 is the key to chemotherapy resistance in MCF7 breast cancer cells under hypoxia
Article Snippet: .. The PCDNA3-Myc3-Nrf2 plasmid was purchased from Addgene (Plasmid #21555). .. The human breast cancer cell lines MCF7 and MDAMB231 were purchased from American Type Culture Collection (ATCC), cultured in DMEM (Invitrogen) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Invitrogen) in a 5% CO 2 atmosphere at 37°C.

Article Title: A NRF2 inhibitor selectively sensitizes KEAP1 mutant tumor cells to cisplatin and gefitinib by restoring NRF2-inhibitory function of KEAP1 mutants.
Article Snippet: Cell Reports 42, 113104, September 26, 2023 17 Rluc8-Nrf2 plasmids (usedfor BRET assay) We used pCDNA-Rluc8 (addgene, a gift from Sanjiv SamGambhir’s lab50; #87121) to clone Nrf2 cDNA upstream and downstream of Rluc8. .. NRF2 cDNA was amplified from pCDNA3-Myc3-NRF2 plasmid (addgene, a gift grom Yue Xiong’s lab51; #21555) using the following primers: NRF2-BamHI-fwd: 50-gcccgaggatcctggatccatgatggacttggagctgcc -30 and NRF2-XbaI-rev: 50- ccctctaga gtttttcttaacatctggct -3’. ..

Polymerase Chain Reaction:

Article Title: Live-cell imaging Unveils stimulus-specific dynamics of Nrf2 activation in UV-exposed melanoma cells: Implications for antioxidant compound screening.
Article Snippet: .. For the plasmid construction, we utilized the pCDNA3-Myc3-Nrf2 plasmid, generously provided by Yue (Addgene plasmid #21555), as the PCR template. ..

Luciferase:

Article Title: Proteasome activation by insulin-like growth factor-1/nuclear factor erythroid 2-related factor 2 signaling promotes exercise-induced neurogenesis.
Article Snippet: Department of Anatomy, Shanxi Medical University, Taiyuan, People's Republic of China Guangdong-Hong Kong-Macau Institute of CNS Regeneration, Joint International Research Laboratory of CNS Regeneration Ministry of Education, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Jinan University, Guangzhou, People's Republic of China Department of Cell Biology, Neurobiology & Anatomy, Medical College of Wisconsin, Milwaukee, Wisconsin, USA Anhui Province Key Laboratory of Medical Physics and Technology, Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China Cancer Hospital, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, People's Republic of China

Amplification:

Article Title: A NRF2 inhibitor selectively sensitizes KEAP1 mutant tumor cells to cisplatin and gefitinib by restoring NRF2-inhibitory function of KEAP1 mutants.
Article Snippet: Cell Reports 42, 113104, September 26, 2023 17 Rluc8-Nrf2 plasmids (usedfor BRET assay) We used pCDNA-Rluc8 (addgene, a gift from Sanjiv SamGambhir’s lab50; #87121) to clone Nrf2 cDNA upstream and downstream of Rluc8. .. NRF2 cDNA was amplified from pCDNA3-Myc3-NRF2 plasmid (addgene, a gift grom Yue Xiong’s lab51; #21555) using the following primers: NRF2-BamHI-fwd: 50-gcccgaggatcctggatccatgatggacttggagctgcc -30 and NRF2-XbaI-rev: 50- ccctctaga gtttttcttaacatctggct -3’. ..



Similar Products

93
Addgene inc yue xiong
Yue Xiong, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pm41667829-249-17-19
Average 93 stars, based on 1 article reviews
yue xiong - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 myc3 nrf2
Pcdna3 Myc3 Nrf2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pmc13000003-352-13-20
Average 93 stars, based on 1 article reviews
pcdna3 myc3 nrf2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc λ red recombinase expression plasmid pmp11
λ Red Recombinase Expression Plasmid Pmp11, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pm41057320-254-14-19
Average 93 stars, based on 1 article reviews
λ red recombinase expression plasmid pmp11 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc myc nrf2
Myc Nrf2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pm25544059__ja5084249_si_001-28-32-36
Average 93 stars, based on 1 article reviews
myc nrf2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 myc3 nrf2 plasmid
Pcdna3 Myc3 Nrf2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3+myc3+nrf2+plasmid/pCDNA3-Myc3-Nrf2+(Plasmid+%2321555)/pm25544059__ja5084249_si_001-125-8-10
Average 93 stars, based on 1 article reviews
pcdna3 myc3 nrf2 plasmid - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results